Quick-ITS Plus NGS Library Prep Kit
with Primer Set 4, 96 rxns
Zymo D6424-PS4

Quick-ITS Plus NGS Library Prep Kit  <br> with Primer Set 4, 96 rxns <br> Zymo D6424-PS4
Quick-ITS Plus NGS Library Prep Kit
with Primer Set 4, 96 rxns
Zymo D6424-PS4
Item# Zymo-D6424-PS4
Regular price: $1,500.00
Sale price: $1,399.99
Size: 

Product Description

Quick-ITS Plus NGS Library Prep Kit  <br> with Primer Set 4, 96 rxns <br> Zymo D6424-PS4
Quick-ITS Plus NGS Library Prep Kit
with Primer Set 4, 96 rxns
Zymo D6424-PS4

Storage Temperature: -20°C

The Quick-ITS Plus NGS Library Prep Kit is the fastest and simplest NGS library prep targeting the ITS region for high-throughput sequencing. The automation-friendly protocol utilizes a single qPCR/PCR for combined targeted amplification and barcode addition using specially designed primers. After pooling by equal volume, a single clean-up of the final library is performed, rather than massive AMPure bead-based clean-ups. Additional library quantification analysis such as TapeStation analysis or gel electrophoresis are not necessary. With these features, the workflow dramatically reduces the hands-on time of library preparation to only 30 minutes.

The most streamlined NGS kit with only 30 minutes of hands-on time for 96 samples. 100% automation ready with only a single PCR step and without the need for normalization. Real-time PCR enables absolute microbial copy number quantification.

Amplicon Size The final amplicon size after 1-Step PCR (targeted amplification and barcode addition) is ~480 bp. Barcode Sequences 10 bp barcodes, Available for download here (USA Only), or under the Documents section as "Barcode Sequences". Index Primers Dual index (barcodes) to uniquely label samples. ITS Primer Sequences (adapters not included) ITS3f (GCATCGATGAAGAACGCAGC, 20 bp), ITS4r (TCCTCCGCTTATTGATATGC, 20 bp). Required Equipment Microcentrifuge, plate spinner (centrifuge), 96-well real-time quantitative PCR system (SYBR Green compatible) or standard PCR system, and 96-well real-time PCR plates. Sample Input Purified microbial DNA ≤100 ng, free of PCR inhibitors. Sequencing Platform Illumina MiSeq without the need to add custom sequencing primers. Zymo Research recommends the MiSeq Reagent Kit v3 (600-cycle). For assistance with sample sheet setup,

Accessories

Quick-ITS Plus NGS Library Prep Kit  <br> with Primer Set 1, 96 rxns <br> Zymo D6424-PS1
Regular price: $1,500.00
Sale price: $1,399.99
Quick-ITS Plus NGS Library Prep Kit
with Primer Set 1, 96 rxns
Zymo D6424-PS1
Zymo-D6424-PS1
Size: 
Quick-ITS Plus NGS Library Prep Kit <br> with Primer Set 2, 96 rxns <br> Zymo D6424-PS2
Regular price: $1,500.00
Sale price: $1,399.99
Quick-ITS Plus NGS Library Prep Kit
with Primer Set 2, 96 rxns
Zymo D6424-PS2
Zymo-D6424-PS2
Size: 
Quick-ITS Plus NGS Library Prep Kit <br> with Primer Set 3, 96 rxns<br> Zymo D6424-PS3
Regular price: $1,500.00
Sale price: $1,399.99
Quick-ITS Plus NGS Library Prep Kit
with Primer Set 3, 96 rxns
Zymo D6424-PS3
Zymo-D6424-PS3
Size: 
Quick-ITS Plus NGS Library Prep Kit  <br> with Primer Set 4, 96 rxns <br> Zymo D6424-PS4
Regular price: $1,500.00
Sale price: $1,399.99
Quick-ITS Plus NGS Library Prep Kit
with Primer Set 4, 96 rxns
Zymo D6424-PS4
Zymo-D6424-PS4
Size: 
Quick-ITS Plus NGS Library Prep Kit,<br>  24 rxns <br> Zymo D6426
Regular price: $500.00
Sale price: $466.99
Quick-ITS Plus NGS Library Prep Kit,
24 rxns
Zymo D6426
Zymo-D6426
Size: